Many studies have evaluated the incidence of antibiotic-resistant bacteria in aquatic environments as a result of unmanaged discharges of animal and urban effluent [1,2]. The present of antibiotics in the environment not only change its ecology, but also it is considered as a trigger of antibiotics resistant [3]. Anti-microbials might be available at levels that couldn't change the biology of the climate yet in addition lead to anti-microbial opposition [3]. A few examinations have revealed that anti-infection resistance designs are turning into a worldwide issue [4,5]. Antibiotic resistance genes are usually acquired either transformation or conjugation. The transmitted of conjugative gene transfer by plasmids with a large variety of hosts It has been widely accepted as a traditional pervasive method of genes transmission in many bacterial species. Several studies have described the horizontal transmission of resistant strains in the ecosystem as a causative agent for development of antibiotic- resistance bacteria [6]. The appearance of Enterobacteriaceae species that express multiple resistance genes for antibiotics and metal are commonly appear as a result of unmanaged release of different waste containing products such as antibiotics and heavy metals in lakes and sewages [7]. Integron that have resistance gene can be moved to other genetic sites or transferred horizontally to other bacteria mainly by conjugative plasmid. There are many types of integron have been identified and distinguished by their respective integrate (IntI) genes. class 1 integrons are strongly associated with multi-resistance seen in Enterobacteriaceae in the hospital environment [8]. 

The importance of such studies, as well as many others like it, would  be   that,   gram negative  microorganisms  and other like contain various plasmids that present them numerous anti-biotic protections from numerous irrelevant anti-toxins and provide the capacity to get by in these threatening conditions particularly in the sewage, where numerous harmful mixtures are regularly released from processing plants in various nations and have no appropriate removal offices [9,10]. Simply because of, Escherichia coli are predominant microbes in sewage and lake, even exchange of anti-microbial obstruction qualities through conjugative plasmids truly do frequently happen among them and in this manner, make these significant microorganisms various impervious to a few anti-o agents [10]. The rate of obstruction among microscopic organisms has been detected basically among clinical disconnects and little is had some significant awareness of the anti-biotic resistance of microbes that happen in the climate. Observing of the coliform’s microorganisms’ thickness in the surface water is basic as safeguard general wellbeing [11]. E. coli are Gram-negative bacteria, have a rod-shaped, belong to the Enterobacteriaceae family. E. coli, a coliform that is typically found in animal digestive systems and refer to fecal contamination in water [12,13]. Few studies have focused on the prevalence of antibiotic resistance in drinking water coliforms, both treated and untreated. [14]. Our current study is the first in Iraq to investigate contamination with antibiotic-resistant coliforms in the waters of Shatt al-Diwaniyah to determine the rate of fecal contamination and its risks to public health in Al- Diwaniyah city.

Study Design and Sample Collection

Present research was cross sectional study included sixty water samples. water samples have been collected from sixty locations of Shatt Al-Diwaniyah water across   the city. Sterile 250-ml polypropylene bottles were used to collected samples, as recommended in internationally methodological approach [15]. Samples are stored at 4°C till their transporting for lab.

Isolation and Identification of Coliform Bacteria

Antibiotic resistant coliform bacteria isolated from water samples by using plates of Mac conky, Caprylate-thallous and Eosin Methylene blue agar in different concentrations (5-100µg/ml).  Plates were incubated at 37°C for 24 hrs., After that, CFU/ml has been used to express the coliform counts. Coliform bacteria appeared as pink colored colonies on Macconky agar plates. While Eosin Methylene blue agar medium showed a greenish appearance have metallic sheen which characterized as E. coli and mucoid appearance with pink color identified as Enterobacter spp. further identification carried out by using of IMViC assays. Pigments characterized Serratia colonies on Caprylate-thallous agar medium selectively isolating in addition to IMViC tests.

Antibiotic Susceptibility Test

All bacterial isolates were subjected to antibiotics sensitivity test by disc-diffusion method. Bacterial resistance of 10 antibiotic discs (Penicillin, Ampicillin, Amoxicillin, Tetracycline, Aminoglycoside, Ciprofloxacin, Cefotaxime, Ceftriaxone, Trimethoprime, Erithromycin) was determined according to the guidelines Recommended by the CLSI, Corresponding to the drugs considered Routine testing and reporting on Enterobacteriaceae (16).

Molecular Study

Molecular determine of integron class 1 (IntI1) gene was conducted by conventional PCR for amplification primer of conserved region of IntI1 gene (forward: GGTCAAGG ATCTGGATTTCG and Reverse: ACATGCGTGTAAATCATCGTC) (20). PCR conditions include: 5 min at 94°C; 32 cycles of 1 min at 94°C, 1 min at 60°C, 2 min at 72°C; 10 min at 72°C then gel electrophoresis of PCR amplification of IntI1 gene for E. coli and Enterobacter was performed under optimal conditions [34].

Statistical Analysis

The studied data were statistically analyzed using the Statistical Packages for Social Sciences, version 22, in addition to Excel 2010. Approximate percentages were relied upon to study significant differences, and a probability value (p value) smaller than 0.05 was considered statistically useful.

This study was conducted on 60 water samples from different areas along the Shatt al-Diwaniyah. The results of the laboratory examination showed that E.coli bacteria were isolated from all samples 100%. We also found Enterobacter bacteria in 70% of the samples, while Serratia appeared in 3%, as in Table 1.

When antibiotics sensitive test preformed, we found that all isolates were resistant to Penicillin, Ampicillin Amoxicillin, and Tetracycline. We also found 85%, 71%, and 50% of E. coli, Enterobacter, and Serratia resistant to aminoglycoside. We also found high resistance of E. coli and Enterobacter to Cefotaxime, 67% and 83%, respectively.  Moreover, we found that E. coli bacteria were more sensitive to the antibiotic Erythromycin, while Enterobacter were more sensitive to the antibiotic Ciprofloxacin, but Serratia bacteria appeared sensitive to Ciprofloxacin, Cefotaxime, Ceftriaxone, Trimethoprim, Erythromycin, as shown in Table 2.

Table 1: Prevalence of isolated Coliforms in Shatt al-Diwaniyah water

Table 2: Determine antibiotics resistance among isolated Coliforms

Figure 1: Gel electrophoresis of PCR amplification of IntI1 gene for E. coli and Enterobacte 

Figure 2: Prevalence of integron class 1 among studied bacterial isolates

Table 3: Relationship between antibiotics resistance and integron

*: non-significant differences) p>0.05)

Increasing of bacterial contamination as seen by pollution biological indicators, represented as a risk factor to the public health, especially in the aspect of resistance and microbial diversity in the water of Shatt Al-Diwaniyah. The presence of fecal coliform in aquatic environments may indicate that the water has been contaminated with the fecal material of humans or other animals [16]. Fecal coliform bacteria can enter rivers through direct discharge of waste from mammals and birds, from agricultural and storm runoff, and from human sewage [17]. By the studies of Davino et al. [30] and Delgado et al. [31], occurred on Jatiúca Beach, Brazil, and Bassaseachic Falls National Park, Mexico water respectively, noticed that Fecal coliform counts were higher during the wet seasons (May, June, and July) than during  the  dry  seasons  (November, December, and January), It thus indicates that water moves during dry seasons. So, our water in Shatt Al-Diwaniyah may be become more contaminate in winter therefore we may be need to other study during this season [30,31].

The global distribution of Enterobacteriaceae strains resistant to antibiotics in aquatic environments, such as surface waters, seawater, river and sewage waters, and shellfish, has been evaluated worldwide recently. Many of an aquatic’s environments have been studied to discover antibiotic resistant Enterobacteriaceae [18]. The levels of drugs in different rivers throughout the world have previously been shown to be high enough to be considered an ecological risk. [19]. Determinants of Antimicrobial resistance may be considered as a form of pollution when Fecal bacteria effected to excessive concentrations of antimicrobials in the human or animal digestive tract release them into the environment. [20,21]. 

In our current study, we found that antibiotic resistance is common among E. coli and Enterobacter isolates isolated from Shatt al-Diwaniyah against ten antibiotics (especially beta lactam antibiotics) while Serratia isolates were more sensitive to these drugs. In Akhter’s study, 5 concentrations of (Penicillin, Erythromycin, Ciprofloxacin, Amoxicillin, and Tetracyclin) were tested and found to be resistant by river water samples of coliform bacteria. (5 to 100µg/ml in comparison with Enterobacter species.  E. Coli isolates were having the higher ratio among all coliforms in resistant to Tetracycline, Erythromycin, Amoxicillin and Ciprofloxacin. Isolates of Enterobacter have a higher resistant percentage only with penicillin and erythromycin [22]. By Akhter et al observation, there was a fluctuating pattern of coliform that -resistant to antibiotic that resulted from receiving of effluent from hospitals, small businesses in the city, and long-term residential sources [22]. A high correlation was found by many authors between the density of bacteria in water of numerous environments (such as beaches and freshwater) and increased antibiotic resistance. Typically, the plants of treatment minimize the number of effluent bacteria by one to three log units [23,24]. However, the number of resistant bacteria is really rising, therefore this decrease is not always followed by a decrease in the percentage of resistant bacteria. Reinthaler et al. commenting on the results of this investigation. Another element that is continuously researched is multi-resistance. [24]. In waste water treatments plants, a study curried by Lefkowitz and Durán [25] for measuring of E. coli multi-resistant, showed that 60 percentage of it were multi -resistant for many antibiotics, as many different studies agreed within the same results carried by other authors on the same factors [26].

Antibiotic resistance in bacteria result either by heredity, or developed by acquisition or spontaneous mutation of resistant genes [27]. In our results, high prevalence of integron class 1 among mist E. coli and Enterobacter isolates that mainly harbour resistance to beta lactam antibiotics. The emergence of bla genes, that encode to vast class of β-lactam enzymes, is the main reason for gram-negative bacteria's resistance to β-lactam antibiotics [28]. Chavez noticed that, mostly in artificial waterways, over 75% of isolates had bla genes during the dry and wet seasons. Almost all artificial and natural water samples contained blaTEM-1, blaCTX-M-9, blaVIM-2, blaIMP-1, and blaAmpC genes, which are dispersed throughout water systems of the city. [29]. Large proportion of bla genes found in environmental isolated proves that they would be exposed to selection antibiotic pressure and/or that resistance genes would spread across water system bacterial populations. [29]. 

Antibiotic resistance and its widespread occurrence in and around Bangladesh are a major public health concern. Recently, a study has reported the occurrence of multi drug resistance coliforms in human sewage collected from different places of Chattogram city, Bangladesh [32]. As a consequence, study Chowdhury et al [33] also investigate the contribution of coliform bacteria from drinking water to the occurrence of antibiotic resistance in Bangladesh. In the same line with our results, Chowdhury et al., study found the presence of a highly important antibiotic resistance gene int1among 40% (n = 4) of identified coliforms [34]. Finally, we did not find sufficient studies dealing with the identification of integron and their relationship to multiple antibiotic resistance in rivers, which are the primary source of drinking and irrigation water in various countries. Therefore, efforts must be made to monitor the spread of antibiotic resistance and the genes that carry it in various environmental settings, especially water.

The results of the current study showed that E. coli and Enterobacter are the most common contaminants in Shatt al-Diwaniyah, and they were carriers’ resistance to many antibiotics, especially beta-lactam antibiotics. We found that integron class 1 is associated with multiple antibiotic resistance of both E. coli isolates and Enterobacter isolates. 

Conflict of Interest

Authors announce that, there is no conflict of interests

Ethical Approval

The study protocol was approved by the local ethics committee.

1. Hellweger, F.L. Forn et al. "A simple model of tetracycline antibiotic resistance in the aquatic environment (with application to the Poudre River)." International Journal of Environmental Research and Public Health, vol. 8, no. 2, 2011, pp. 480–497.

2. Heuer, O.E. Forn et al. "Human health consequences of use of antimicrobial agents in aquaculture." Clinical Infectious Diseases, vol. 49, no. 8, 2009, pp. 1248–1253.

3. Davies, J. Forn et al. "Origins and evolution of antibiotic resistance." Microbiology and Molecular Biology Reviews, vol. 74, no. 3, 2010, pp. 417–433.

4. Krahulcová, M. Forn et al. "Characterization of antibiotic resistant coliform bacteria and resistance genes isolated from samples of smoothie drinks and raw milk." Foods, vol. 11, no. 9, 2022, p. 1324.

5. Sharma, D. Forn et al. "Antibiotics versus biofilm: An emerging battleground in microbial communities." Antimicrobial Resistance & Infection Control, vol. 8, 2019, pp. 1–10.

6. Iversen, A. Forn et al. "High prevalence of vancomycin-resistant enterococci in Swedish sewage." Applied and Environmental Microbiology, vol. 68, no. 6, 2002, pp. 2838–2842.

7. Sarwar, A. Forn et al. "Paper currency harbours antibiotic-resistant coliform bacteria and integron integrase." Journal of Applied Microbiology, vol. 130, no. 5, 2021, pp. 1721–1729.

8. Khadhim, M.K., and M.A. Kazaal. "Antibiotics resistance and integron class 1 among commensal Escherichia coli." AL-Qadisiya Medical Journal, vol. 13, no. 24, 2017, pp. 1–10.

9. Kazaal, M.A. Forn et al. "Impact of antibiotic resistance on sustainable development goals." AIP Conference Proceedings, vol. 2776, 2023, p. 020016. https://doi.org/10.1063/5.0137246.

10. World Health Organization. Antimicrobial Resistance: Global Report on Surveillance. 2014. https://apps.who.int/iris/handle/10665/112642.

11. Lépesová, K. Forn et al. "Hospital wastewater—Important source of multidrug-resistant coliform bacteria with ESBL-production." International Journal of Environmental Research and Public Health, vol. 17, no. 21, 2020, p. 7827.

12. Yousif, I.M. Forn et al. "Evaluation of tap water quality and molecular identification of Escherichia coli O157 in Al-Kut City, Iraq." Caspian Journal of Environmental Sciences, vol. 20, no. 5, 2023, pp. 1053–1057.

13. Pathak, S.P., and K. Gopal. "Bacterial contamination and antibiotic resistance in fecal coliforms from glacial water runoff." Bulletin of Environmental Contamination and Toxicology, vol. 79, no. 2, 2007, pp. 163–167.

14. Nalepa, B. Forn et al. "Seasonal variances in bacterial microbiota and volatile organic compounds in raw milk." International Journal of Food Microbiology, vol. 267, 2018, pp. 70–76.

15. Xi, C. Forn et al. "Prevalence of antibiotic resistance in drinking water treatment and distribution systems." Applied and Environmental Microbiology, vol. 75, no. 17, 2009, pp. 5714–5718.

16. Lösch, L.S. Forn et al. "Occurrence of antimicrobial-resistant Enterobacteriaceae in water from different sources in a subtropical region of Argentina." Ambiente & Água: An Interdisciplinary Journal of Applied Science, vol. 3, no. 2, 2008, pp. 28–36.

17. Mitch, A.A. Forn et al. "Fecal coliform accumulation within a river subject to seasonally-disinfected wastewater discharges." Water Research, vol. 44, no. 16, 2010, pp. 4776–4782.

18. Kostyla, C. Forn et al. "Seasonal variation of fecal contamination in drinking water sources in developing countries: A systematic review." Science of the Total Environment, vol. 514, 2015, pp. 333–343.

19. Alonso, A. Forn et al. "Environmental selection of antibiotic resistance genes." Environmental Microbiology, vol. 3, no. 1, 2001, pp. 1–9.

20. Martinez, J.L. "Environmental pollution by antibiotics and by antibiotic resistance determinants." Environmental Pollution, vol. 157, no. 11, 2009, pp. 2893–2902.

21. Khadhim, M.M., and M.A. Kazaal. "Antibiotics resistance and integron class 1 among commensal Escherichia coli." AL-Qadisiya Medical Journal, vol. 13, no. 24, 2018, pp. 1–9.

22. Chaturvedi, S. Forn et al. "Multiple antibiotic resistance patterns of rhizospheric bacteria isolated from Phragmites australis growing in constructed wetland for distillery effluent treatment." Journal of Environmental Biology, vol. 29, no. 1, 2008, pp. 117–124.

23. Akhter, A. Forn et al. "Antimicrobial resistant coliform bacteria in the Gomti river water and determination of their tolerance level." Bioinformation, vol. 10, no. 4, 2014, pp. 167–174.

24. De Oliveira, A.J., and J.M. Pinhata. "Antimicrobial resistance and species composition of Enterococcus spp. isolated from waters and sands of marine recreational beaches in Southeastern Brazil." Water Research, vol. 42, no. 8-9, 2008, pp. 2242–2250.

25. Reinthaler, F.F. Forn et al. "Antibiotic resistance of E. coli in sewage and sludge." Water Research, vol. 37, no. 8, 2003, pp. 1685–1690.

26. Lefkowitz, J.R., and M. Duran. "Changes in antibiotic resistance patterns of Escherichia coli during domestic wastewater treatment." Water Environment Research, vol. 81, no. 9, 2009, pp. 878–885.

27. Pignato, S. Forn et al. "Molecular epidemiology of ampicillin resistance in Salmonella spp. and Escherichia coli from wastewater and clinical specimens." Foodborne Pathogens and Disease, vol. 7, no. 8, 2010, pp. 945–951.

28. Berendonk, T.U. Forn et al. "Tackling antibiotic resistance: The environmental framework." Nature Reviews Microbiology, vol. 13, no. 5, 2015, pp. 310–317.

29. Bengtsson-Palme, J., and D.G. Larsson. "Antibiotic resistance genes in the environment: Prioritizing risks." Nature Reviews Microbiology, vol. 13, no. 6, 2015, pp. 396.

30. Chavez, M.V. Forn et al. "Occurrence of β-lactamase-producing gram-negative bacterial isolates in water sources in Cali City, Colombia." International Journal of Microbiology, 2019, Article ID 1375060.

31. Davino, A.M. Forn et al. "Assessing the sources of high fecal coliform levels at an urban tropical beach." Brazilian Journal of Microbiology, vol. 46, no. 4, 2015, pp. 1019–1026.

32. Delgado-Gardea, M.C. Forn et al. "Multidrug-resistant bacteria isolated from surface water in Bassaseachic Falls National Park, Mexico." International Journal of Environmental Research and Public Health, vol. 13, no. 6, 2016, p. 597.

33. Chowdhury, A.M.M.A. Forn et al. "Screening and identification of antibiotic resistant gene int1 in coliforms isolated from drinking water." Air, Soil and Water Research, vol. 15, 2022.

34. Akter, S. Forn et al. "Antibiotic resistance and plasmid profiling of Escherichia coli isolated from human sewage samples." Microbiology Insights, vol. 14, 2021, Article ID 11786361211016808.

35. Kargar, M. Forn et al. "High prevalence of class 1 to 3 integrons among multidrug-resistant diarrheagenic Escherichia coli in southwest of Iran." Osong Public Health and Research Perspectives, vol. 5, no. 4, 2014, pp. 193–198.