Contents
Download PDF
pdf Download XML
520 Views
104 Downloads
Share this article
Research Article | Volume 6 Issue 1 (Jan-June, 2025) | Pages 1 - 5
Multi-Locus Sequence Typing Analysis of Carbapenem-Resistant Escherichia coli from Diabetic Foot infections in Diwaniya City, Iraq
1
Department of Clinical Laboratory Science, Pharmacy College, University of Al-Qadisiya, Iraq
Under a Creative Commons license
Open Access
Received
March 12, 2025
Revised
April 22, 2025
Accepted
May 19, 2025
Published
May 27, 2025
Abstract

Diabetic foot infections represent significant complications associated with diabetes mellitus, often complicated by the development of multidrug-resistant pathogens. This study aimed to investigate the molecular characteristics of carbapenem-resistant Escherichia coli isolates recovered from diabetic foot infections through Multi-Locus Sequence Typing (MLST). A total of nine clinical samples were collected from private laboratories in Diwaniya City, Iraq. The VITEK 2 Compact system was utilized for bacterial identification and antimicrobial susceptibility analysis. All isolates demonstrated resistance to multiple antibiotics, including amoxicillin/clavulanic acid, piperacillin/tazobactam, ertapenem and imipenem, various cephalosporins, and trimethoprim/sulfamethoxazole. Three isolates selected for MLST that carried out using seven housekeeping genes, with amplification achieved via PCR followed by sequencing. Sequence typing showed that the isolates were categorized into diverse sequence types: ST34, ST218, and ST10. These findings indicate that carbapenem-resistant E. coli strains causing diabetic foot infections in Diwaniya are genetically diverse. Further studies employing comprehensive molecular typing methods are warranted to better understand the epidemiology and transmission dynamics of these resistant strains.

Keywords
INTRODUCTION

Diabetic foot infections are serious complications of diabetes that frequently lead to chronic infections and amputations of lower-limbs. The rising occurrence of multidrug-resistant bacteria in these infections hampers therapy and markedly deteriorates clinical outcomes. [1]. There is a high prevalence of carbapenems resistant E. coli in diabetic foot infections, with isolates often harboring multiple carbapenemase genes. Increasing of biofilm production among these organisms further impede treatment by diminishing antibiotic efficacy and promoting the horizontal transfer of resistance genes [2]. Carbapenems are β-lactam antibiotics typically reserved for the treatment of severe infections caused by Gram-negative bacteria conferring multidrug-resistance through their broad spectrum of stability and activity against most β-lactamases. However, the increasing emergence and dissemination of carbapenemase-generating E. coli strains have markedly undermined their clinical effectiveness [3]. These enzymes, including OXA-48-like carbapenemases, and Klebsiella pneumoniae carbapenemase (KPC), are capable of carbapenems and other β-lactam antibiotics hydrolysis, thereby conferring resistance and rendering these antimicrobial agents ineffective [4]. Molecular typing techniques are crucial for elucidating the epidemiology and evolutionary dynamics of carbapenem-resistant E. coli. Among these, Multi-Locus Sequence Typing (MLST) has emerged as a widely used method for characterizing bacterial isolates through the sequencing of conserved housekeeping genes, enabling robust strain differentiation and phylogenetic analysis [5]. MLST offers a standardized and reproducible method for classifying bacterial strains into sequence types (STs),   facilitating the identification   and   global  tracking of high-risk clones and their epidemiological spread [6]. Given the limited published data on MLST characterization of E. coli, particularly carbapenem-resistant strains in Iraq, objective   of  this   research was to examine the sequence types of carbapenem-resistant E. coli isolated from diabetic foot infections in Diwaniya City.


 

METHODOLOGY

Sample Collection

A total of 9 bacterial isolates of carbapenem resistant E coli collected from diabetic foot recovered from different private laboratories in Diwaniya city/Iraq through January to July 2024. 

 

Isolation and Antibiotic Sensitivity Evaluation of Bacterial Strains

The samples were inoculated directly onto MacConkey agar, then incubated at 37°C for twenty-four hours. Isolates were subsequently identified using the VITEK 2 Compact system (BioMérieux, France), employing the VITEK® 2 GN card following the instructions provided by the manufacturer. antimicrobial sensitivity evaluation wase done also by VITEK 2 Compact system using VITEK 2 AST cassette which evaluate 17 antibiotics: Imipenem, Amoxicillin/Clavulanic Acid, Meropenem, Piperacillin/Tazobactam, Ertapenem, Cefuroxime, Cefazolin, Ceftriaxone, Cefuroxime Axetil, Trimethoprim/Sulfamethoxazole, Ciprofloxacin, Ceftazidime, Fosfomycin, Gentamicin, Amikacin, Nitrofurantoin and Cefepime.

 

Extraction of DNA from Bacterial Isolates

In the present study, 3 carbapenem resistant E. coli isolates selected for molecular analysis, Genomic DNA was extracted from bacterial broth cultures following the guideline’s protocol using Genomic DNA Mini Kit (Geneaid, Taiwan). The extracted DNA quality and concentration were assessed using a Nanodrop (Thermo/USA). Purified    DNA  of   Isolates    were  then stored in microcentrifuge tubes at –20°C for subsequent use in PCR amplification.

 

PCR Analysis

Extracted DNA of the 3 selected E. coli isolates was set to PCR using forward (F) and reverse primers (R) of housekeeping genes used by Tartof et al. [7] (Table 1).

 

A 25 μL volume of PCR reaction mixture was prepared including: 12.5 μl of Go Taq Green Master Mix (2X), 10 pM/μL (2.5 μl) of forward primer, 10 pM/μl (2.5 μl) of reverse primer, 5 μl of DNA template, and 2.5 μl of nuclease-free water. The reaction mixtures were transferred into PCR tubes and amplified using a thermal cycler (BioRad, USA) under the conditions specified in Table 2.


Fragments of amplified PCR were electrophoresed on agarose gel (1.5% concentration) and visualized under UV light with ethidium bromide staining (3 μl) in a dark environment. The electrophoresis was conducted using Tris-borate-EDTA (TBE) buffer as the running medium. The first well of the gel was loaded with a 100–2000 bp DNA ladder (Roche, New Jersey, USA) to determine the molecular size of the amplicons. The electrophoresis system was run at a constant voltage of 80 V for 1.5 hours. Visualization of DNA bands was performed under UV light using an UVItec imaging system (Paisley, UK). 

 

DNA sequencing and MLST analysis

The PCR products of the seven housekeeping amplified gene products were sent to Macrogen Company, Korea, via DHL courier service using ice-packed containers to ensure sample integrity, and sequenced using the ABI DNA Sequencing System. After that, sequence results of selected carbapenem resistant E. coli isolates were examined using MLST according to the seven-gene Achtman scheme alleles available at the database https://pubmlst.org/. [8]. The isolates characterizations submitted and recorded in the same website.

RESULTS

The molecular characterization of the selected carbapenem-resistant Escherichia coli isolates was performed through PCR amplification of seven housekeeping genes. Each of these genes yielded a distinct and expected PCR product size, confirming their presence and amplifiability under the applied experimental conditions. The results are visually represented in Figure 1, where the electrophoretic separation of the amplified products demonstrates clear, specific bands corresponding to the anticipated molecular weights for each target gene. This consistency in amplification across all seven loci supports the reliability of the PCR protocol employed and provides a solid foundation for further genetic analyses, such as MLST, which relies on accurate amplification and sequencing of these conserved genomic regions.

 

Table 1: Seven Housekeeping Genes Primers Sequences Used in the Study

Primers Primer SequencesAnnealing temp (°C)Amplicon size (bp)

Adk

ATTCTGCTTGGCGCTCCGGG

52

583

CCGTCAACTTTCGCGTATTT

FumC  

TCACAGGTCGCCAGCGCTTC

52 

806

GTACGCAGCGAAAAAGATTC

Icd  

ATGGAAAGTAAAGTAGTTGTTCCGGCACA

52

878

GGACGCAGCAGGATCTGTT

PurA  

CGCGCTGATGAAAGAGATGA

54  

816

CATACGGTAAGCCACGCAGA

GyrB  

CATACGGTAAGCCACGCAGA

58  

911

TCGGCGACACGGATGACGGC

RecA  

CGCATTCGCTTTACCCTGACC

58  

780

TCGTCGAAATCTACGGACCGGA

Mdh  

ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG

58  

932

TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 1: Agarose gel electrophoresis showing positive results of the seven housekeeping genes in three selected isolates of carbapenem-resistant Escherichia coli

 

 

Table 2: PCR Thermocycling Parameters for Amplification of Target Genes Using Specific Primer Sets in This Study

Genes                                    Temperature (C0) / TimeHoldCycle Number
Initial denaturationCycling conditionFinal extension
DenaturationAnnealingExtension
Adk95/ 5 min94/ 30 sec52/ 30 sec72/ 2 min72/ 7min4C030
FumC95/ 5 min94/ 30 sec52/ 30 sec72/ 2 min72/ 7min4C030  
Icd95/ 5 min94/ 30 sec 52/ 30 sec72/ 2 min72/ 7min4C030
PurA95/ 5 min94/ 30 sec54/ 30 sec72/ 2 min72/ 7min4C030
GyrB95/ 5 min94/ 30 sec58/ 30 sec72/ 2 min72/ 7min4C030
RecA95/ 5 min94/ 30 sec58/ 30 sec72/ 2 min72/ 7min4C030
Mdh95/ 5 min94/ 30 sec58/ 30 sec72/ 2 min72/ 7min4C030

 

Antimicrobial Sensitivity Testing

The antimicrobial susceptibility profile of carbapenem-resistant Escherichia coli revealed alarming resistance rates across a range of antibiotics, figure 2, underscoring a significant public health concern. In current study, all isolates demonstrated resistance to piperacillin/tazobactam, amoxicillin/clavulanic acid, imipenem, ertapenem, cefazolin, cefuroxime, cefuroxime axetil, ceftazidime, ceftriaxone, and trimethoprim/sulfamethoxazole, with resistance rates reaching 100%. Furthermore, meropenem and cefepime exhibited slightly lower resistance rates of 88.88%. Notably, aminoglycosides such as gentamicin and amikacin displayed a resistance frequency of 33.33%, indicating a concerning trend in the efficacy of these treatment options. Additionally, Fosfomycin and nitrofurantoin were less impacted, with resistance rates of 44.44% and 22.22%, respectively. Carbapenem-resistant Gram-negative bacteria represent a growing global public health threat, with increasing prevalence reported both in Iraq and worldwide. These organisms are particularly concerning due to their high levels of multidrug resistance, which significantly limit therapeutic options and contribute to increased morbidity and mortality. Among carbapenem-resistant isolates in Iraq, the most frequently identified resistance genes are bla OXA-48 and bla NDM-1, which have been increasingly associated with clinical isolates, including those recovered from complex infections such as diabetic foot ulcers [9].

 

Although there is a paucity of published studies specifically addressing carbapenem-resistant Escherichia coli isolated from diabetic foot infections in Iraq, the results of the present antimicrobial susceptibility testing align with previous findings by Al-Mayahie et al., who recommended the empirical use of aminoglycosides and nitrofurantoin in the treatment of uropathogenic E. coli infections in Iraqi patients [10. Similarly, a study conducted in India demonstrated that aminoglycosides were among the most effective antimicrobial agents against E. coli isolates causing diabetic foot infections [11]. These findings suggest that aminoglycosides may still retain some efficacy against resistant E. coli strains, at least in certain geographic regions. Nevertheless, the emergence and spread of carbapenem resistance underscore the urgent need for continuous surveillance of antimicrobial resistance patterns, along with the development and implementation of novel therapeutic strategies and infection control measures to combat these challenging pathogens.

 

Multi-Locus Sequence Typing

A multi-locus sequence typing (MLST) analysis of Escherichia coli showed that isolate 1 exhibited a sequence type (ST) 34 with allelic profile: adk-10, fumC-11, gyrB-4, icd-1, mdh-8, purA-8, recA-2, and was assigned to clonal complex ST10 complex. Isolate 2 displayed ST218 with an allelic profile of adk-10, fumC-11, gyrB-4, icd-12, mdh-8, purA-8, recA-2, also belonging to the ST10 complex. Isolate 3 showed ST10 with allelic profile adk-10, fumC-11, gyrB-4, icd-8, mdh-8, purA-8, recA-2, forming part of the same clonal complex. table 3, 4. Various studies conducted in Iraq have underscored the clinical significance of E. coli in diabetic foot infections. For instance, AL-Sahi et al. reported that E. coli was the most commonly isolated Gram-negative pathogen, representing 15 out of 41 (36.58%) identified isolates among patients with diabetic foot ulcers [12]. This highlights the prominent role of E. coli in such infections and emphasizes the need for targeted surveillance and management strategies. However, despite the growing recognition of E. coli as a major pathogen in this context, there remains a notable gap in the literature regarding molecular characterization of these isolates. To the best of our knowledge, no studies have yet investigated molecular typing—particularly MLST—of carbapenem-resistant E. coli recovered from diabetic foot infections in Iraq. However, the three E. coli sequence types identified in this study have been previously reported in both clinical    and   non-clinical   settings    across    various Countries, highlighting their widespread distribution and ecological versatility. Sequence Type 10 (ST10) has been isolated from diverse sources, including human clinical specimens such as urine samples in Jordan and Australia [13-14] as well as from cases of acute diarrhea, healthy children, and food samples in India. Similarly, ST34 has been recovered from comparable clinical and environmental sources, including urine, diarrheal cases, and food products, in addition to immunocompromised patients, animal stool, and meat, indicating its broader host range and potential for zoonotic transmission [15]. Meanwhile, the third sequence type detected in this study ST218 has previously been documented in swine populations in China [16] and in environmental water samples from a lake in Cambodia [17], underscoring its presence in both livestock and aquatic ecosystems. The detection of these globally reported sequence types in E. coli isolates from diabetic foot infections suggests possible transmission links between human, animal, and environmental reservoirs, and emphasizes the importance of a One Health approach in understanding the epidemiology of antimicrobial resistance. On the other hand, three selected isolates in the present study shared clonal complex despite variation in certain allele numbers and sequence types.

 

 

Figure 2: Antimicrobial Susceptibility Profile of 9 Isolates of Carbapenem-Resistant Escherichia Coli

 

Table 3: Multi-Locus Sequence Typing of Escherichia coli

Isolate No.Housekeeping Gene AlleleClonal Complex
STadkfumCgyrBicdmdhpurArecA
134101141882ST10 cplx
22181011412882ST10 cplx
310101148882ST10 cplx


 

 

Table 4: Isolates number and ID of three E coli isolates recorded in www. Pubmlst.org website

Isolate no.Isolate nameSourceID
1EC1Diabetic Foot23418
2CE2Diabetic Foot23419
3EC3Diabetic Foot23420

 

In conclusion, this study highlights the presence of carbapenem-resistant Escherichia coli among diabetic foot infection cases in Diwaniya City, Iraq, with molecular typing revealing genetic diversity among the isolates, as demonstrated by the identification of distinct sequence types (ST34, ST218, and ST10). The observed multidrug resistance profile, including resistance to β-lactams and other clinically relevant antibiotics, underscores the therapeutic challenges associated with these infections. While these findings contribute to the expanding body of knowledge on antimicrobial resistance patterns and molecular epidemiology in diabetic foot infections, the study is limited by its small sample size, which restricts the generalizability of the results. Subsequent studies with large sample sizes and broader geographic coverage are recommended to better understand the clonal distribution and transmission dynamics of carbapenem-resistant E. coli in clinical settings.

REFERENCE
  1. Perez Calvo, C., García-García, B., Marrugo-Padilla, V., Montes-Sierra, D., and Alvarado-Castell, H. "Diabetic foot. Tools for the identification of the foot at risk and its timely intervention." Arch de Medi, vol. 17, no. 7, 2021.

  2. Saleem, M. et al. "Prevalence and molecular characterization of carbapenemase-producing multidrug-resistant bacteria in diabetic foot ulcer infections." Diagnostics, vol. 15, no. 2, 2025, pp. 141.

  3. Nordmann, P., Naas, T., and Poirel, L. "Global spread of carbapenemase-producing Enterobacteriaceae." Emerging infectious diseases, vol. 17, no. 10, 2011, pp. 1791.

  4. Aslan, A. T., and Paterson, D. L. "Epidemiology and clinical significance of carbapenemases in Australia: a narrative review." Internal Medicine Journal, vol. 54, no. 4, 2024, pp. 535–544.

  5. Maiden, M. C. et al. "Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms." Proceedings of the National Academy of Sciences, vol. 95, no. 6, 1998, pp. 3140–3145.

  6. Wirth, T. et al. "Sex and virulence in Escherichia coli: an evolutionary perspective." Molecular microbiology, vol. 60, no. 5, 2006, pp. 1136–1151.

  7. Tartof, S. Y., Solberg, O. D., Manges, A. R., and Riley, L. W. "Analysis of a uropathogenic Escherichia coli clonal group by multilocus sequence typing." Journal of clinical microbiology, vol. 43, no. 12, 2005, pp. 5860–5864.

  8. Jolley, K. A., Bray, J. E., and Maiden, M. C. "Open-access bacterial population genomics: BIGSdb software, the PubMLST. Org website and their applications." Wellcome open research, vol. 3, 2018, pp. 124.

  9. Hasan, S. A., Raoof, W. M., and Kamal Rachid, S. "A systematic review: the current status of carbapenem resistance in Iraq." World Bulletin of Public Health, vol. 13, 2022, pp. 88–94.

  10. Gatya Al-Mayahie, S. M. et al. "Prevalence of common carbapenemase genes and multidrug resistance among uropathogenic Escherichia coli phylogroup B2 isolates from outpatients in Wasit Province/Iraq." PloS one, vol. 17, no. 1, 2022, pp. e0262984.

  11. Singh, A. K. et al. "A study on diabetic foot ulcers in central rural India to formulate empiric antimicrobial therapy." Journal of family medicine and primary care, vol. 9, no. 8, 2020, pp. 4216–4222.

  12. AL-Sahi, M. M., Ali, M. M., and AL-Hasnawi, S. M. J. "Microbiological detection of some pathogenic bacteria in diabetic foot ulcers of type 1 and 2 diabetic mellitus patients." University of Thi-Qar Journal of Science, vol. 10, no. 1, 2023, pp. 128–131.

  13. Zueter, A. M. et al. "Multi-locus sequence typing of Escherichia coli isolated from clinical samples in Jordan." The Journal of Infection in Developing Countries, vol. 18, no. 4, 2024, pp. 571–578.

  14. Li, D. et al. "Dominance of Escherichia coli sequence types ST73, ST95, ST127 and ST131 in Australian urine isolates: a genomic analysis of antimicrobial resistance and virulence linked to F plasmids." Microbial Genomics, vol. 9, no. 7, 2023, pp. 001068.

  15. Modgil, V. et al. "Sequence types of enteroaggregative Escherichia coli strains recovered from human, animal, and environmental sources: India." Gene Reports, vol. 37, 2024, pp. 102017.

  16. Yao, H. et al. "Multiple copies of Bla NDM-5 located on conjugative megaplasmids from porcine Escherichia coli sequence type 218 isolates." Antimicrobial Agents and Chemotherapy, vol. 64, no. 5, 2020, pp. 10–1128.

  17. Yoneda, I. et al. "Detection and genetic analysis of Escherichia coli from Tonle Sap Lake and its tributaries in Cambodia: spatial distribution, seasonal variation, pathogenicity, and antimicrobial resistance." Environmental Pollution, vol. 315, 2022, pp. 120406.
Recommended Articles
Research Article
Serum IL-22, miRNA-146a Expression and Total Antioxidant Status as Integrated Biomarkers in Rheumatoid Arthritis
Published: 13/08/2026
Download PDF
Research Article
Electrochemical Comparative Studies On The Redox Behavior Of Cu(II) And Cr(II) Before And After Interactions With Ciprofloxacin In Solutions
Published: 10/08/2021
Download PDF
Research Article
A Rare Case Report of Waugh Syndrome in an Eight Months Old Male
...
Published: 10/03/2021
Download PDF
Research Article
Study on Prevalence and Etiology of Early Neonatal Deaths in Jasin district, Melaka from 2014-2017
...
Published: 30/05/2021
Download PDF
Chat on WhatsApp
Flowbite Logo
PO Box 101, Nakuru
Kenya.
Email: office@iarconsortium.org

Editorial Office:
J.L Bhavan, Near Radison Blu Hotel,
Jalukbari, Guwahati-India
Useful Links
Order Hard Copy
Privacy policy
Terms and Conditions
Refund Policy
Shipping Policy
Others
About Us
Team Members
Contact Us
Online Payments
Join as Editor
Join as Reviewer
Subscribe to our Newsletter
+91 60029-93949
Follow us
MOST SEARCHED KEYWORDS
Copyright © iARCON International LLP . All Rights Reserved.