Background: Urinary tract infection (UTIs) is one of the most common infections afflicting women. Hemolysins or haemolysins was a potential virulence factor produced by microorganisms (M.O). Probiotic refer to harmless live normal flora M.O, which are mostly strains of Lactobacillus spp., Bifidobacterium spp., and others. These microorganisms help the host's health when given in the right dosages. Aims: To identify gram -ve bacterial species isolated from urinary tract infections, and also to evaluate in-vitro the antimicrobial activity of antibiotic and also to evaluate in-vitro the antimicrobial activity of selected probiotic species and antibiotic against some pathogenic bacteria, and hemolysin gene detection. Methods: A total 200 urine specimens were collected from patients with UTIs, that include pregnant (n = 100, 50%), non-pregnant (n = 100, 50%). Bacterial colonies were Gram stained and microscopically examined. Biochemical tests were done to identify pathogen species. The Kirby-Bauer disk diffusion method was used for antibiotic testing.The well diffusion method and agar spot method was used for detection probiotic affectivity to a group of bacteria isolated and Detection of some virulence genes of bacterial isolates by PCR. Results: The result of identification revealed that the number of patients were with significant bacteriuria among 200 urine specimens with positive culture was 60% and The UPEC was presented (26.7%) of samples culture, P. aeruginosa 5.8% and P. mirabilis 3.3%. Diagnosis using PCR of 16S rRNA of isolates was 100% positive for all isolates. The E. coli isolates was 100% for both Hly-A and Hly-B gene, P. aeruginosa Hly-1 (plcH) and Hly-2 (exlA) were 85.7% and 71.4% respectively; whereas, P. mirabilis Hly-A (hmpA) and Hly-B (hmpB) were 50% and 75%, respectively. The UPEC and P. mirabilis isolates show higher resistance level of the present study for lincomycin, Rifampin, Amoxicillin-clavulanate, colistin and Nalidixic acid were 100%, while the P. mirabilis were most resistant to colistin, Nalidixic acid and Amoxicillin-clavulanate were 100%. In susceptibility testing using well diffusion method, L. acidophilus had effect against 77% (p = 0.008) and L.Plantarium had coverage against (90%) (p = 0.003). Lactobacillus acido and L. Plantarum 95%, while in agar spot method, L. acidophilus had effect against 82% and L. plantarium had coverage against 95%, and L. acido and L. plantarum was 100%. Conclusion: most isolates was resistant to colistin Nalidixic acid and Azithromycin, This investigation showed Hly-A and Hly-B are a gene found in bacterial cells that allows them to be resistant to antibiotics.This study indicates the antibacterial efficacy properties of Lactobacillus spp., to inhibit the growth in-vitro of pathogenic bacteria but probiotic cannot inhibit strong biofilm formation for all isolates.
Urinary tract infection (UTIs) is one of the most common infections afflicting women. UTIs in women are one of the most prevalent infections occurring at different stages of life. Female are much more prone to UTIs than male, mainly due to the female lower urinary tract anatomy and its proximity to the reproductive organ [1], and to the short urethra and colonization of the peri-urethral area by pathogens from the gastro-intestinal tract. From the peri-urethral area, pathogens ascend to colonize the urinary bladder or kidneys [1-2]. In addition, UTIs incidence is estimated about 150 million persons per year [3].
Microorganisms (M.O) that causing UTIs in pregnancy are the same uropathogens which commonly cause UTIs in non-pregnant patients. Furthermore, Escherichia coli (E. coli) is the most common organism isolated. An 18-year retrospective analysis found E. coli to be the causative agent in 82.5% of cases of pyelonephritis in pregnant patients. Other bacteria which may be seen include Klebsiella pneumoniae, Staphylococcus, Streptococcus, Proteus, Pseudomonas spp., and Enterococcus spp.
The Gram-negative hemolysins (cytolysins) are usually synthesized as precursor proteins, then covalently modified to yield an active hemolysin and secreted via specific export systems, which differ for various types of hemolysins. Hemolysins or haemolysins was a potential virulence factor produced by M.O, it was lipids and proteins that cause lysis of red blood cells by forming pores and disrupting the cell membrane [4]. Uropathogenic E. coli (UPEC) and Alpha-hemolysin of Staphylococcus aureus the major M.O that produce hemolysins that can cause cystitis, pyelonephritis, and sepsis, expression of hemolysin correlates with severity of infection, as up to 78% of UPEC isolates from pyelonephritis patient cases express hemolysin, harbor infectious isolates with up to 78% encoding operon hemolysins gene [5]. The organisms that cause UTIs during pregnancy are the same as those found in non-pregnant patients. E. coli accounts for 80-90% of infections [6]. The most common bacteria that cause UTIs in women were E. coli. Klebsiella spp, Proteus spp, Pseudomonas spp, Salmonella spp, Aeromonas spp, Serratia spp, Neisseria spp, Providencia spp, Acinetobacter spp, Veillonella spp, Citrobacter spp and Bacteroids spp [7].
Escherichia coli (E. coli) is a Gram-negative, facultative anaerobic, rod-shaped, coliform bacterium of the genus Escherichia. Also, UPEC strains have a significant genetic diversity that contributes to colonization and persistence in the urinary tract, even in immunocompetent patients. Despite the numerous virulence factor VFs related to the occurrence of UTIs, including Alpha-hemolysin (HlyA), encoded by the hlyA gene in a pathogenicity island, causes the lysis of erythrocytes, endothelial cells, and urinary tract cells, enabling bacteria to capture iron and escape from phagocytes [8].
Proteus mirabilis (P. mirabilis) is a Gram-negative, facultatively anaerobic, rod-shaped bacterium. It shows swarming motility and urease activity. In addition, P. mirabilis causes 90% of all Proteus infections in humans [9]. In addition, P. mirabilis has many factors of virulence, Proteus mirabilis hemolysin genes are a two-part secretion (hpmA and hpmB), [10].
Pseudomonas aeruginosa (P. aeruginosa) is a common encapsulated, Gram-negative, aerobic–facultatively anaerobic, rod-shaped bacterium [8]. In addition, probiotics were live M.O that is intended to have health benefits when consumed or applied to the body. An October 2001 report by the World Health Organization (WHO) defines probiotics as "live microorganisms which when administered in adequate amounts confer a health benefit on the host [11].
Patients and Study Design
A total 200 urine specimens were collected from patients with UTIs, that include pregnant (n = 100, 50%), non- pregnant (n = 100, 50%), with age 13 – 44 years, during the period from 1th August, 2022 to 25th December, 2022 that admitted to Al-Kut Maternity and child hospital, Al-Zahra Teaching Hospital, and private clinics in Wasit province. Samples were taken by sterile disposable cotton swabs and transport swab. They were, then, cultured onto (Blood agar base, Brain heart infusion Agar, Brain heart infusion broth, Muller-Hinton agar, Nutrient agar) plates before incubating aerobically and (anaerobically with Co2) at 37ºC for (24h to 48h). After that, identified based on colony morphology, microscopic Gram stain investigation, capability of blood heamolysis, standard biochemical tests and Vitek 2 system, and 16s rRNA.
Table 1: Sequences of All Primers Were Used In the Present Study
| Primer | Sequence (5'-3') | Product Size | Genbank | |
| 16S rRNA gene Escherichia coli | F | TCCGGAGCTAACGCGTTAAG | 459bp | LC682250.1 |
| R | AGTTGCAGACTCCAATCCGG | |||
16S rRNA gene Proteus mirabilis | F | AGTTGCAGACTCCAATCCGG | 363bp | FN650811.1 |
| R | TTCGATGCAACGCGAAGAAC | |||
16S rRNA gene Pseudomonas aeruginosa | F | ATGCCTAGGAATCTGCCTGG | 700bp | LN874213.1 |
| R | TCGTTTACGGCGTGGACTAC | |||
| Hla gene E. coli | F | AGGGGATGCTTTACTCGCAG | 513bp | KM596784.1 |
| R | AACTCCTTCGGTTGAGCCTC | |||
| Hlb gene E. coli | F | GGAGTTAGTGCAGCCTCCAG | 419bp | U12572.1 |
| R | AACTCCTTCGGTTGAGCCTC | |||
hmpA gene P. mirabilis | F | GTTGAGGGGCGTTATCAAGAGTC | 709bp | Ghaima et al., 2019 |
| R | GATAACTGTTTTGCCCTTTTGTGC | |||
hmpB gene P. mirabilis | F | CAGTGGATTAAGCGCAAATG | 422bp | Ghaima et al., 2019 |
| R | CCTTCAATACGTTCAACAAACC | |||
Hemolysin 1gene P. aeruginosa | F | CTGGTACCTGTACGTCGACG | 328bp | FN650811.1 |
| R | GAGGATGAACACGGTCCTGG | |||
Hemolysin 2gene P. aeruginosa | F | GACTACATCCTGGCCAACCC | 512bp | LN874213.1 |
| R | TTCAGGCTGTTGTCGGGAAG | |||
Table 2: PCR Thermocycler System of 16srrna, Hly-A Gene and Hly-B Gene
| PCR step. | Temp. | Time | No. cycles |
| Initial denaturation | 95 | 5mnts | 1 |
| Denaturation | 95 | 30 sec |
35 |
| Annealing | 581 | 30 sec | |
| Extension | 72 | 30 sec | |
| Final-extension | 72 | 5mnts | 1 |
| Hold | 4 | ∞ | 12 |
Exclusion and Inclusion Criteria
In order to include all women (pregnant and non-pregnant) patients in the current study who had suspected UTIs with age 13-44, the records were carefully examined. Patients undergoing an antibiotic therapy prior to the study were excluded and bacteria that not cause hemolysis on blood agar excluded too.
Antimicrobial Susceptibility Test
According to The Clinical and Laboratory Standards Institute (CLSI, 2022) standards, the antibiotic sensitivity of isolates was determined on Mueller Hinton agar using the Kirby-Bauer disk diffusion method [12].
Molecular Detection
Polymerase chain reactions (PCR) primers were designed in the current study using NCBI Genbank sequence database design, online software and these primers were synthesized by Scientific Researcher Co. Ltd, Iraq, as summarized in the Table 1.
PCR Thermo Cycler Program
Polymerase chain reaction thermo cycler conditions for S.aureus and Str. sanguinis amplification reactions were done using convential PCR thermo cycler system is same for each gene except for annealing temperature as following the Table 2.
All PCR products were detected by 2% agarose gel (100volts for 45minut) and visualized by staining with 1μl of Ethidium bromide stain then documentation was performed by the gel documentation saving picture (vision, UK).
Methods for Detection Anti-Bacterialactivity of Lactobacillus acidophilus, Lactobacillus plantarum and Lactobacillus Acidophilus and Plantarum Together
Lactobacillus acidophilus, Lactobacillus plantarum and Lactobacillus acidophilus and plantarum together were obtained from the commercial capsule, Wasit University. These two bacteria were then cultured in 10ml of MRS broth at 37°C anaerobically for 24-48 hours.
Well Diffusion Method
In current study, Lactobacillus acidophilus, Lactobacillus plantarum and Lactobacillus acidophilus and plantarum together, were cultured in MRS broth at 37°C with 5% CO2 for 24 hours, and used as the broth culture bacteria (BCB). In addition, the isolates were grown in broth culture and incubated at 37°C for 24 hours. In addition, cell free supernatant (CFS) for Lactobacillus spp. was obtained by centrifuging the culture at 10000 rpm/15 minutes then Nowroozi et al. [13] clarified that the supernatant via a filter paper of 0.22μm pore size.
The suspension had a turbidity of 0.5 McFarland. Then, 100µl of pathogenic bacteria were swabbed onto the nutrient agar plates as an inoculum. The plate then departed for an hour. On the cultured plates, three wells (6 mm in diameter) were formed. After that, add 50µl of Lactobacillus spp., each BCB and CFS were independently poured into wells [14] following 24 hours, CO2 and 37°C incubation period. Zone diameter of inhibitions (ZDIs) values were measured in mm and classified as less active when ZDIs were less than 10, moderately active when ZDIs were between 11 and 14, and extremely active when ZDIs were greater than 15 [15].
Agar Spot Method
All strains were tested for antimicrobial activity against the pathogens isolates. Spots of Lactobacillus spp. from an overnight culture in MRS broth were placed on the surface of MRS agar, and colonies were then allowed to grow for 24 hours at 37°C. The pathogenic bacteria were put into semi-solid nutritional medium (1.3g nutrient broth + 0.75g nutrient agar in 100ml D.W) and then poured over MRS agar after 24 hours of culture. The plates were incubated for 24 hours at 37°C, and then an inhibitory zone was then examined. The areas of inhibition were categorized as (−) for no visible inhibition, (+) for inhibition between 0.5 and 6mm, (++) for inhibition between 7 and 12mm, and (+++) for inhibition of more than 12 mm [16].
Statistical Analysis
Statistical-Package-for-Social-Science, version 25.0 for windows was used to do statistical analysis on all data. All findings with a significant level (p≤0.05) were analyzed using Chi Square [17].
Patient age Groups
The results were distributed according to the patient age between 13-44 years old. The lowest incidence was among 35-44 Y age group (17.0%), while the highest incidence was among 25-34Y age group (43.5%).
Isolation and Identification of Pathogen
The cultural characteristics of urine isolates on different media such as (Blood agar, MacConkey agar, Cetrimide agar, Eosin Methylene Blue (EMB), and Mannitol salt agar), gram stain and biochemical test and according to the vitek-2 system result and finally by 16sRNA.The result of identification revealed that the number of patients with significant bacteriuriaamong 200 urine specimens with positive culture was 60% and the negative (no growth) was 40%, may be due to Fungal or viral infections. The number of patients with significant bacteriuria was higher in pregnant 55%.
In the currant the most prevalence pathogen in UTI that cause heamolysis on blood agar was G+ve bacteria 25 (62.5%), S.aureus andS.haemolyticuswith 15 37.5% and 10 25% respectivelly, and the G-ve bacteria that cause heamolysis on blood agar was 15 37.5%, P.aeuroginosa n = 7 17.5%, Proteus n = 4 10% and E. coli n = 4 10%, Table 3.
The UPEC was presented 26.7% of samples culture, K. pneumoniae 13.3%, P. aeruginosa 5.8% and P. mirabilis (3.3%).
Table 3: Prevalence Pathogenic Bacteria Inpregnant and Non-Pregnant With Age Group
| Bacteria | No. | % | Patient's with Bacteria | ||||
| Pregnancy | Age (Year) | ||||||
| Pregnant | Non Pregnant | 13-24 | 25-34 | 35-44 | |||
| S.haemolyticus | 10 | 25 | 5 | 5 | 5 | 3 | 2 |
| S.aureus | 15 | 37.5 | 8 | 7 | 6 | 8 | 1 |
| Proteus | 4 | 10 | 4 | 0 | 1 | 2 | 1 |
| E.coli | 4 | 10 | 2 | 2 | 1 | 3 | 0 |
| P.aeuroginosa | 7 | 17.5 | 4 | 3 | 2 | 5 | 0 |
| p-Value | 0.495 | 0.656 | |||||

Figure 1: Antibiotic Susceptibility Pattern of E. coli Isolates

Figure 2: Antibiotic Susceptibility Pattern of Proteus Isolates
Antibiotic Susceptibility
According to CLSI 2022, guidelines and by Kirby-Bauer disk diffusion method, on Muller-Hinton agar a total of 15of S. aureus isolates, 10 S. haemolyticus, 4 E. Coli, 4 P. mirabilis, and 7 P. aeuroginosa, were exposed to susceptibility testing using different antibiotics as mentioned above.
The Antibiotic susceptibility test of UPEC isolates Showed higher resistance level of the present study for lincomycin, Rifampin, Amoxicillin-clavulanate, colistin and Nalidixic acid were 100%, and Trimethoprim-sulfamethoxazole and Azithromycin were 75%, while the lowest resistance were to Imipenem, Cefoxitin, Pipracacilin – tazobactam and Ciprofloxacin were 0.0%, with high significant p-Value 0.001 (Figure 1).
The result of Antibiotic susceptibility test of P. mirabilis isolates In The present study showed that the isolates were most resistant to lincomycin, Rifampin, Amoxicillin-clavulanate, colistin and Nalidixic acid were 100%, and to Cefoxitin, Pipracacilin – tazobactam and Azithromycin were 75%, with intermediate resistant to Ticarcillin- clavulanic acid, and the most isolates were sensitive to Ciprofloxacin 100%, Amikacin, Imipenem and Levofloxacin were 75%, p-Value 0.0003. (Figure 2).
Antibiotic susceptibility test of P. aeruginosa isolates, the current study showed that the isolates were most resistant to colistin, Nalidixic acid and Amoxicillin-clavulanate were 100%, and Trimethoprim-sulfamethoxazole was 0%, and the higher sensitivity was to Imipenem, Ciprofloxacin and Trimethoprim-sulfamethoxazole with 71.4% with high significant p-Value 0.0001 (Figure 3).

Figure 3: Antibiotic Sensitivity Pattern of P. aeruginosa
Molecular Results
Extraction of DNA in Different Isolates of Pathogenic Bacteria: The DNA forP. aeruginosa, P. mirabilis and E. Coli were extracted. Additionally, NanoDrop was used to confirm the nucleic acid purity and concentration.

Figure 4: Agarose Gel Electrophoresis Image That Showed PCR Product Analysis of 16S Ribosomal RNA Gene for Detection Escherichia Coliisolates. M (Marker Ladder 2000-100bp). Lane (1-4) Showed Some Positive Escherichia Coli Isolates 16S Ribosomal RNA Gene at 459Bp Product Size

Figure 5: Agarose Gel Electrophoresis Image That Showed PCR Product Analysis of 16S Ribosomal RNA Gene for Detection Pseudomonas Aeruginosaisolates. M (Marker Ladder 2000-100bp). Lane (1-7) Showed Some Positive Pseudomonas Aeruginosa Isolates 16S Ribosomal RNA Gene at 700Bp Product Size

Figure 6: Agarose Gel Electrophoresis Image That Showed PCR Product Analysis of 16S Ribosomal RNA Gene for Detection Proteus Mirabilisisolates. M (Marker Ladder 2000-100bp). Lane (1-4) Showed Some Positive Proteus Mirabilis Isolates 16S Ribosomal RNA Gene at 363Bp Product Size

Figure 7: Agarose Gel Electrophoresis Image That Showed PCR Product Analysis of Hla and Hlb Genes in Escherichia Coli Isolates. M (Marker Ladder 2000-100bp). Lane (1-4) Showed Positive Hla Gene Escherichia Coli Isolates at 513bp Product Size and Lane (1-4) Showed Positive Hlb Gene Escherichia Coli Isolates at 419bp Product Size

Figure 8: Agarose Gel Electrophoresis Image That Showed PCR Product Analysis Of Hemolysin 1 And Hemolysin 2 Genes In Pseudomonas Aeruginosa Isolates. M (Marker Ladder 2000-100bp). Lane (1-7) Showed Some Positive Hemolysin 1 Gene Pseudomonas Aeruginosa Isolates at 328bp Product Size and Lane (1-7) Showed Some Positive Hemolysin 2 Gene Pseudomonas Aeruginosa Isolates At 512bp Product Size

Figure 9: Agarose Gel Electrophoresis Image That Showed PCR Product Analysis of Hmpa and Hmpb Genes in Proteus Mirabilis Isolates. M (Marker Ladder 2000-100bp). Lane (1-4) Showed Positive Hmpa Gene Proteus Mirabilis Isolates at 709bp Product Size and Lane (1-4) Showed Some Positive Hmpb Gene Proteus Mirabilis Isolates At 422bp Product Size
Molecular Detection of 16S rRNA of Isolates
Diagnosis using PCR was regarded the golden and confirmatory diagnosis which takes a short period compared to other methods this specific detection of most conserved region of target bacteria recorded E. coli 4(100%), P. aeruginosa 7(100%), P. mirabilis were 4(100%), isolates, as showed in the Figure 4-6.
Detection of some Virulence Genes of Bacterial Isolates
The polymerase chain reaction was performed todetect the presence of the genes (Hly -A and Hly-B) for E. coli, P. aeruginosa, and P. mirabilis (Table 2).
In current study the Hemolysin gene of the E. coli isolates was 4 (100%) for both Hly-Aand Hly-B gene (Figure 7).
Diagnosis for hemolysin gene using PCR recorded that the P. aeruginosa Hly-1(plcH) and Hly-2(exlA)were 6(85.7%) and 5(71.4%) respectivelly Figure 8.
The results in the present study revealed that the P. mirabilis Hly-A (hmpA) and Hly-B (hmpB) 2(50%) 3(75%) respectively (Figure 9).
Table 4: Antimicrobial Effect (%) of Lactobacillus Acidophilus, Lactobacillus Plantarum and Lactobacillus Acidophilus and Plantarum Together Against Some Bacteria Isolate Using Well Diffusion Method
| Bacteria | L. acido | L. plantarium | L. acido and L. plantarum | p-Value | |||
| No. | % | No. | % | No. | % | ||
| Proteus | 3 | 75 | 4 | 100 | 4 | 100 | 0.008 |
| e.coli | 4 | 100 | 4 | 100 | 4 | 100 | 1.000 |
| P.aeuroginosa | 4 | 57 | 5 | 71.4 | 6 | 85.7 | 0.013 |
Table 5: Antimicrobial Effect (%) of Lactobacillus Acidophilus, Lactobacillus Plantarum and Lactobacillus Acidophilus and Plantarum Together Against Some Bacteria Isolate Using CFS Well Diffusion Method
| Bacteria | Proteus | E. coli | P. aeuroginosa | |||||
| No. | % | No. | % | No. | % | |||
| L. acido | Active | ≥15 mm | ||||||
| Moderate | 11-14 mm | 1 | 25 | 1 | 25 | 2 | 28.6 | |
| Less active | ≤10 mm | 2 | 50 | 3 | 75 | 2 | 28.6 | |
| L. plantarium | Active | ≥15 mm | ||||||
| Moderate | 11-14 mm | 3 | 75 | 2 | 50 | 2 | 28.6 | |
| Less active | ≤10 mm | 1 | 25 | 2 | 50 | 3 | 42.9 | |
| L. acido and L. plantarum | Active | ≥15 mm | ||||||
| Moderate | 11-14 mm | 4 | 100 | 4 | 100 | 3 | 42.9 | |
| Less active | ≤10 mm | 0 | 0 | 0 | 3 | 42.9 | ||
Table 6: Antimicrobial Effect (%) of Lactobacillus Acidophilus, Lactobacillus Plantarum and Lactobacillus Acidophilus and Plantarum Together Against Some Bacteria Isolate Using BCB Well Diffusion Method
| Bacteria | Proteus | E. coli | P. aeuroginosa | |||||
| No. | % | No. | % | No. | % | |||
| L. acido | Active | ≥15 mm | 2 | 50 | 2 | 50 | 3 | 42.9 |
| Moderate | 11-14 mm | 1 | 25 | 2 | 50 | 1 | 14.3 | |
| Less active | ≤10 mm | - | - | - | - | - | - | |
| L. plantarium | Active | ≥15 mm | 4 | 100 | 3 | 75 | 3 | 42.9 |
| Moderate | 11-14 mm | 0 | 0 | 1 | 2% | 2 | 29 | |
| Less active | ≤10 mm | - | - | - | - | - | - | |
| L. acido and L. plantarum | Active | ≥15 mm | 4 | 100 | 4 | 100 | 6 | 85.7 |
| Moderate | 11-14 mm | - | - | - | - | - | - | |
| Less active | ≤10 mm | - | - | - | - | - | - | |
Table 7: Antimicrobial Effect (%) of Lactobacillus Acidophilus, Lactobacillus Plantarum and Lactobacillus Acidophilus and Lactobacillus Plantarum Together Against Some Bacteria Isolate Using Agar Spot Method
| Bacteria | L. acido | L. plantarium | L. acido and L. plantarum | p-Value | |||
| No. | % | No. | % | No. | % | ||
| Proteus | 3 | 75 | 4 | 100 | 4 | 100 | 0.008 |
| E.coli | 4 | 100 | 4 | 100 | 4 | 100 | 1.000 |
| P.aeuroginosa | 5 | 71 | 6 | 85.7 | 7 | 100.0 | 0.009 |
Effect of Some Probiotic on Bacteria Isolated from UTIs
Antimicrobial affect of Lactobacillus acidophilus, Lactobacillus plantarum and Lactobacillus acidophilus and plantarum togetheron some isolated bacterial from UTIs using well-diffusion and agar-spot methods. The inhibition zone was measured by millimeters (mm). The results in the present study with probiotic bacteria against different bacteria isolated from the UTIs were showed that the variance of inhibition ability ranging in case of bacterial culture broth (BCB) from 11-24 mm and in case of cell free supernatant (CFS) from 9-15 mm using well diffusion method, while in agar spot method, the inhibition ability ranging from 12-26. , as illustrated in the Table 4.
The highest inhibition zone of BCBby Lactobacillus plantarum was 24 mm; meanwhile, highest inhibition zone by L. acidophilus was 19 mm, and the Lactobacillus acidophilus and plantarum together was 26–29-mm growth inhibition zone using well diffusion method. In addition, the highest inhibition zone of CFS in both Lactobacillus plantarumand L. acidophilus was 15 mm, and 11 mm, respectively and Lactobacillus acidophilus and Lactobacillus plantarum together was 24–28-mm (Table 5-6).
Agar spot method is another method to detect the antimicrobial effect of Lactobacillus plantarum and Lactobacillus acidophilus and Lactobacillus plantarum together against some bacteria isolate, as showed in the Table 3.
Comparison of the Effect of Antibiotics and Probiotics on Biofilm Formation by Some Pathogenic Skin Wound Bacteria Isolates
In this current study the effect of Lactobacillus acidophilus, Lactobacillus plantarum and Lactobacillus acidophilus and plantarum together on biofilm formation for bacteria showed in well diffusion method and agar spot method by statically analysis p-Value=0.00712, that means it had ability to prevent biofilm formation. In addition, Lactobacillus acidophilus and plantarum together also showed a relationship with inhibition of biofilm formation for pathogenic bacteria in well diffusion method and agar spot method by statically analysis (p = 0.007) respectively. The effect of both lactobacillus spp., bacteria on these bacteria by statically analysis indicated there are relationship of probiotic and inhibition of strong biofilm formation, as in (Table 7- 8).
Table 8: Antimicrobial Effect (%) of Lactobacillus Acidophilus, Lactobacillus Plantarum and Lactobacillus Acidophilus and Plantarum Together Against Some Bacteria Isolate Using Well Diffusion Method
| Antibacterial | Proteus | E.coli | P.aeuroginosa | |||
| No. | % | No. | % | No. | % | |
| Strong Biofilm | 2 | 50% | 3 | 75% | 7 | 100% |
| L. acido | 3 | 75% | 4 | 100% | 4 | 57% |
| L. plantarum | 4 | 100% | 4 | 100% | 5 | 71% |
| L. acido and L. plantarum | 4 | 100% | 4 | 100% | 6 | 86% |
| TOP | S (50%) | S (50%) | R (57.1) | |||
| NA | R (100%) | R (100%) | R (100%) | |||
| CIP | R (100%) | S (100%) | S (71.4%) | |||
| AZTH | R (75%) | R (75%) | - | |||
| TZP | S (50%) | S (50%) | I (57.1%) | |||
| CAZ | R (50%) | R (50%) | R (57.1) | |||
| CT | R (100%) | R (100%) | R (100%) | |||
| AMC | R (100%) | R (100%) | R (100%) | |||
| LEV | S (50%) | S (50%) | S (42.9%) | |||
| RA | R (100%) | R (100%) | - | |||
| FOX | S (75%) | S (75%) | - | |||
| L | R (100%) | R (100%) | - | |||
| IMP | S (75%) | S (75%) | S (71.4%) | |||
| F | S (50%) | R (50%) | - | |||
| SXT | R (75%) | R (75%) | S (71.4%) | |||
| AK | I (50%) | I (50%) | R (42.9%) | |||
| TTC | S (50%) | S (50%) | - | |||
Chi-Square = 13.584, p-Value = 0.00712
This study appeared that the pregnant women had a significantly higher infected with UTIs and uropathogenic bacteria than non-pregnant women and can be associated with adverse outcomes for both the mother and fetus [18].The results of percentage of G-ve bacteria were achieved by Ali et al. [19], which revealed the majority of the isolates belong to the G-negative bacilli 49(71%).The results of Ab sensitivity for UBEC were agreed with result founded by Rahman et al. [20] and the result of Mohammed et al. [21] in Iraq. Another result that be in close concur which by Yazdanpouret al. [22] that revealed, 90.3% amoxicillin, 67.7% trimethoprim-sulfamethoxazole, 61.3% cephalexin, 59.7% ceftriaxone, 58.1% cefotaxime, 43.5% ciprofloxacin, 41.9% azithromycin, 40.3% ceftazidime, 27.4% gentamycin and minimum antibiotic resistance was detected against fosfomycin (1.6%), nitrofurantoin (3.2%) and imipenem (1.6%). These result of susceptibility to antibiotic of P. mirabilis disagreed with Mirzaei et al., [23] who show the resistance to antibiotics was 15.5% to ciprofloxacin, 13.6% to norfloxacin, 12.7% to tobramycin, 11.8% to Imipenem, 4.5% to meropenem, and 2.7% to amoxicillin-clavulanic acid. Others similar study achieved by Hussein et al., [24]/ Iraq, showed that the susceptibilityrate for ceftriaxone was 96.8%, followed by norfloxacin (82.5%), ciprofloxacin (69.8%), Nalidixic acid (42.9%), sulfamethoxazole (39.7%), and Nitrofurantoin (3.2%). Extensive misuse of this class of antibiotics resulted in a significant increase in resistance to them in P. mirabilis isolates [22]. Similar investigation of susceptibility for P. aeruginosa results by He et al. showed that 54% resistance was observed for ciprofloxacin. A total of 26% resistance was noted for Piperacillin / tazobactam, 14% resistance seen in Imipenem. Other study conducted by Bekele et al. [25]; and Tetz et al. [26] show that the most effective antibiotic in UTIs treatment against P. aeruginosa was Ciprofloxacin with 100% percentage. The results in the present study of Hly gene of E. coli agreed with study achieved by Noori and Jassim Mohamad [27] in Kirkuk - Iraq, showed that E. coli isolates possessed the hlyA gene isolated from urine was (75%). While, the result in the present study disagreed with another study achieved by Audrey and Procter [28], who showed that hly-A gene expressed in the E. coli was 26 carried hlyA (21.7%). The result conducted by Moeinizadeh and Shaheli, [29], Shiraz city/Iran, revealed that the frequencies of hlyA and hlyB genes were calculated as 50% and 43%, respectively and that disagree with the results in current study. The result in current study for Hly of P. aeruginosa agreed with Ghanem et al. [30], who showed that the PCR amplification results presence of plcH (Hly-A ) was 75.2% genes. The result in current study agreed with Andhale et al. [31] who showed that the PCR amplification results presence of plcH (Hly-A) genes in 73.33%. The results in the present study agreed with another study achieved by Faraji et al. [32], who showed thatplcH gene in Pseudomonas aeruginosa were 79%.The present study revealed that the P. mirabilisindicated that the hemolysin genes (hpmA and hpmB) agreed with the found of Kais et al. [33] who show the hpmA and hpmB were 96 (87.3 %) of the 110 Proteus mirabilis isolates. The results of Cestari et al. [34] showed similar results of the current study, who demonstrated the presence of the hpmA and hpmB genes was confirmed by PCR in 205 (97.15 %) of the 211 isolates. There is evidence that hemolysin increases the virulence of infections by P. mirabilis because production of this protein has been correlated with cytotoxicity in vitro cells, also it was found that observed that P. mirabilis that produced haemolysin associated to the cell produced a lethal dose 50 % greater than the non-hemolytic isolates when injected transurethrally in mice [33]. These results of Antimicrobial effect of Lactobacillus spp. come in accordant to another study conducted by Al-Azzawi et al. who showed that the inhibition zone by BCB higher than CFS. The Lactobacillus plantarum showed high significant (p<0.003) ability to inhibit growth of P. aeruginosa, P. mirabilis, and E. coli more than L. acidophilus (p<0.004) by using well diffusion method. The results of CFS agreed with Klewicka et al. [35]. The results in the current study come in accordant to another study achieved by Dallal et al. [36], who revealed that the probiotic Lactobacillus plantarumenhancement of inhibitory zone diameters in well diffusion method higher than others against P. aeruginosawith 100% effect. In addition, these results in the current study agreed with another study achieved by Al-Asady et al. who showed that the effect of L. acidophilus (13 mm) with 100%. Moreover, Soltani et al. who found that L acidophilus had ability to inhibit of E. coli isolated from UTIs was16 mm with 100%. Tigu et al. have also revealed that Lactobacillus isolates inhibited the growth of E. coli with inhibition zones ranging from 10 to 14 mm in diameters. In the present study, the results showed that the agar spot method is slightly more effective method in compared to well diffusion method. In comparison to the well diffusion method, the agar spot method was generally highly effective. Cultivated on liquid culture, these results agreed with another study conducted by Al-Azzawi et al.
This study shows that most isolates have haemolysin gene and most isolates resist for lincomycin, Rifampin, Amoxicillin-clavulanate, colistin and Nalidixic acid. Lactobacillus spp., has antibacterial effectiveness and immunological characteristics against pathogenic bacteria that cause UTIs
Czajkowski, K. et al. “Urinary tract infection in women.” Menopause Review/Przegląd Menopauzalny, vol. 20, no. 1, 2021, pp. 40–47.
Wing, D.A. et al. “Acute pyelonephritis in pregnancy: An 18-year retrospective analysis.” American Journal of Obstetrics and Gynecology, 2013.
Al-Tulaibawi, N.A.J. “Prevalence and sensitivity of bacterial urinary tract infection among adult diabetic patients in Misan province, Iraq.” Journal of Pure and Applied Microbiology, vol. 13, no. 2, 2019, pp. 847–853.
Stipcevic, T. et al. “Di-rhamnolipid from Pseudomonas aeruginosa displays differential effects on human keratinocyte and fibroblast cultures.” Journal of Dermatological Science, vol. 40, no. 2, 2005, pp. 141–143.
Ristow, L.C., and Welch, R.A. “Hemolysin of uropathogenic Escherichia coli: A cloak or a dagger?” Biochimica et Biophysica Acta (BBA) - Biomembranes, vol. 1858, no. 3, 2016, pp. 538–545.
Balachandran, L. et al. “Urinary tract infection in pregnancy and its effects on maternal and perinatal outcome: A retrospective study.” Cureus, vol. 14, no. 1, 2022.
Nkwelle, C.E. et al. “Asymptomatic urinary tract infection in pregnant and non-pregnant women in the Limbe Health District of Cameroon: A phenotypic and biochemical analytic study.” 2022.
Nascimento, J.A. et al. “Frequency and diversity of hybrid Escherichia coli strains isolated from urinary tract infections.” Microorganisms, vol. 9, no. 4, 2021, pp. 693.
Majeed, H.T., and Aljanaby, A.A.J. “Antibiotic susceptibility patterns and prevalence of some extended spectrum beta-lactamases genes in gram-negative bacteria isolated from patients infected with urinary tract infections in Al-Najaf City, Iraq.” Avicenna Journal of Medical Biotechnology, vol. 11, no. 2, April–June 2019, pp. 192–201.
Etxaniz, A. et al. “Irreversible versus repairable membrane poration: Differences in permeabilization elicited by Bordetella adenylate cyclase toxin and its hemolysin domain in macrophages.” The FEBS Journal, vol. 287, no. 9, 2020, pp. 1798–1815.
National Center for Complementary and Integrative Health. “Probiotics: What you need to know.” US National Institutes of Health, August 2019.
Sharma, S., and Srivastava, P. “Resistance of antimicrobial in Pseudomonas aeruginosa.” International Journal of Current Microbiology and Applied Sciences, vol. 5, no. 3, 2016, pp. 121–128.
Nowroozi, J. et al. “Study of Lactobacillus as probiotic bacteria.” Iranian Journal of Public Health, vol. 33, no. 2, 2004, pp. 1–7.
El-Mokhtar, M.A. et al. “Antagonistic activities of cell-free supernatants of lactobacilli against extended-spectrum β-lactamase producing Klebsiella pneumoniae and Pseudomonas aeruginosa.” Infection and Drug Resistance, 2020, pp. 543–552.
Halder, D. et al. “Indigenous probiotic Lactobacillus isolates presenting antibiotic-like activity against human pathogenic bacteria.” Biomedicines, vol. 5, no. 2, 2017, pp. 31.
Abe Sato, S.T. et al. “Isolation and genetic identification of endophytic lactic acid bacteria from the Amazonian açai fruits: Probiotic features of selected strains and their potential to inhibit pathogens.” Frontiers in Microbiology, vol. 11, 2021, p. 610524.
Al-Gharban, H.A.A.J. “Seroepidemiological detection and culture utilization for diagnosis of carrier horses and donkeys with strangles.” Journal of Education College Wasit University, vol. 1, no. 28, 2017, pp. 649–660.
Habak, P.J., and Griggs, R.P. “Urinary tract infection in pregnancy.” 2019.
Ali, A.H. et al. “Prevalence and antimicrobial susceptibility pattern of urinary tract infection among pregnant women attending Hargeisa Group Hospital, Hargeisa, Somaliland.” Scientific Reports, vol. 12, no. 1, 2022, pp. 1419.
Rahman, M. et al. “Association of antibiotic resistance traits in uropathogenic Escherichia coli (UPEC) isolates.” Canadian Journal of Infectious Diseases and Medical Microbiology, 2022.
Mohammed, E.J. et al. “Relationship between antibiotic resistance patterns and O-serogroups in uropathogenic Escherichia coli strains isolated from Iraqi patients.” Jundishapur Journal of Microbiology, vol. 14, no. 8, 2021.
Yazdanpour, Z. et al. “Significant association between genes encoding virulence factors with resistance and phylogenetic groups in community acquired uropathogenic Escherichia coli isolates.” BMC Microbiology, vol. 20, no. 1, 2020, pp. 1–9.
Mirzaei, A. et al. “Characterization of antibiotic-susceptibility patterns, virulence factor profiles and clonal relatedness in Proteus mirabilis isolates from patients with urinary tract infection in Iran.” Infection and Drug Resistance, 2019, pp. 3967–3979.
Hussein, E.I. et al. “Assessment of pathogenic potential, virulent genes profile, and antibiotic susceptibility of Proteus mirabilis from urinary tract infection.” International Journal of Microbiology, 2020.
Bekele, T. et al. “Pseudomonas aeruginosa isolates and their antimicrobial susceptibility pattern among catheterized patients at Jimma University Teaching Hospital, Jimma, Ethiopia.” BMC Research Notes, vol. 8, 2015, pp. 1–4.
Tetz, G.V. et al. “Treatment of chronic relapsing urinary tract infection with antibiotics selected by AtbFinder.” Urology Case Reports, vol. 46, 2023, pp. 102312.
Noori, A.A., and Jassim Mohamad, S. “Detection of capsule production, biofilm formation in Escherichia coli isolated from different sources in Kirkuk City.” Scholastic: Journal of Natural and Medical Education, vol. 2, no. 3, 2023, pp. 146–151.
Audrey, S., and Procter, S. “Employers’ views of promoting walking to work: A qualitative study.” International Journal of Behavioral Nutrition and Physical Activity, vol. 12, no. 1, 2015, pp. 1–10.
Moeinizadeh, H., and Shaheli, M. “Frequency of hlyA, hlyB, hlyC and hlyD genes in uropathogenic Escherichia coli isolated from UTI patients in Shiraz.” GMS Hygiene and Infection Control, vol. 16, 2021, Doc25. https://doi.org/10.3205/dgkh000396.
Ghanem, S.M. et al. “Prevalence of quorum sensing and virulence factor genes among Pseudomonas aeruginosa isolated from patients suffering from different infections and their association with antimicrobial resistance.” Infection and Drug Resistance, 2023, pp. 2371–2385.
Andhale, J.D., and Misra, R.N. “Study of detection of plcH gene and its phenotypic expression in Pseudomonas aeruginosa isolated from various clinical samples.” IOSR Journal of Dental and Medical Sciences, vol. 20, no. 1, January 2021, pp. 42–46.
Faraji, F. et al. “Molecular detection of virulence genes in Pseudomonas aeruginosa isolated from children with cystic fibrosis and burn wounds in Iran.” Microbial Pathogenesis, vol. 99, 2016, pp. 1–4.
KassimGhaima, K. et al. “Molecular study of hemolysin genes in Proteus mirabilis isolated from patients with urinary tract infections.” Research Journal of Pharmaceutical, Biological and Chemical Sciences, vol. 10, no. 1, January–February 2019, p. 2149.
Cestari, S.E. et al. “Molecular detection of HpmA and HlyA hemolysin of uropathogenic Proteus mirabilis.” Current Microbiology, vol. 67, 2013, pp. 703–707.
Klewicka, E. et al. “Antagonistic activity of lactic acid bacteria and Rosa rugosa Thunb. pseudo-fruit extracts against Staphylococcus spp. strains.” Applied Sciences, vol. 12, no. 8, 2022, pp. 4005.
Dallal, M.S. et al. “Inhibitory effect of Lactobacillus plantarum and Lb. fermentum isolated from the faeces of healthy infants against nonfermentative bacteria causing nosocomial infections.” New Microbes and New Infections, vol. 15, 2017, pp. 9–13.